After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey FCGR3 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus FCGR3 cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:765bp
cDNA Description:Full length Clone DNA of Macaca mulatta Fc gamma RIIIa with N terminal HA tag.
Gene Synonym:FCGR3, FcRIII
Species:Cynomolgus
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Fc receptors bind the most common class of antibody, IgG, are called Fc gamma receptors (FcγR). FcγR is divided into three classes, Fc γ RI (CD64), Fc γ RII (CD32), and Fc γ RIII (CD16). CD16 protein is a multifunctional, low/intermediate affinity receptor, which belongs to the immunoglobulin superfamily. It is found on the surface of natural killer cells, neutrophil polymorphonuclear leukocytes, monocytes and macrophages. Mouse CD16 is encoded by a single gene, while, human CD16 is expressed as two distinct forms (CD16a/FcγRIIIa and CD16b/FcγRIIIb) encoded by two different highly homologous genes in a cell type-specific manner. CD16 is involved in phagocytosis, secretion of enzymes, inflammatory mediators, antibody-dependent cellular cytotoxicity (ADCC), and clearance of immune complexes.

References
  • Edberg JC, et al. (2002) Genetic linkage and association of Fcgamma receptor IIIA (CD16A) on chromosome 1q23 with human systemic lupus erythematosus. Arthritis Rheum. 46(8): 2132-40.
  • Li P, et al. (2002) Recombinant CD16A-Ig forms a homodimer and cross-blocks the ligand binding functions of neutrophil and monocyte Fcgamma receptors. Mol Immunol. 38(7): 527-38.
  • Li P, et al. (2007) Affinity and kinetic analysis of Fcgamma receptor IIIa (CD16a) binding to IgG ligands. J Biol Chem. 282(9): 6210-21.
  • Size / Price
    Catalog: CG90013-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"