Quick Order

Human PDK1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PDK1 cDNA Clone Product Information
Gene_bank_ref_id:BC039158
RefSeq ORF Size:1311bp
cDNA Description:Full length Clone DNA of Homo sapiens pyruvate dehydrogenase kinase, isozyme 1 with C terminal His tag.
Gene Synonym:PDK1
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Pyruvate dehydrogenase kinase, isozyme 1, also known as [Pyruvate dehydrogenase [lipoamide]] kinase isozyme 1, mitochondrial and PDK1, is a member of the PDK / BCKDK protein kinase family. PDK-1 is expressed predominantly in the heart. It contains one histidine kinase domain. Pyruvate dehydrogenase kinase (PDK) isoforms are molecular switches that downregulate the pyruvate dehydrogenase complex (PDC) by reversible phosphorylation in mitochondria. An inhibitory effect of lipoic acid on PDKs would result in less phosphorylation of E1 and hence increased PDC activity. At least two isoenzymic forms of pyruvate dehydrogenase kinase ( PDK-1 and PDK-2 ) may be involved in the regulation of enzymatic activity of mammalian pyruvate dehydrogenase complex by phosphorylation. PDK-3 appears to have the highest specific activity among the three isoenzymes. PDK-1 inhibits the mitochondrial pyruvate dehydrogenase complex by phosphorylation of the E1 alpha subunit, thus contributing to the regulation of glucose metabolism.

References
  • Gudi R., et al., 1995, J. Biol. Chem. 270:28989-94.
  • Mooney,B.P. et al., 2000, Biochem Biophys Res Commun. 267 (2): 500 - 503.
  • Korotchkina,L.G. et al., 2004, Free Radic Res. 38 (10):1083-92.
  • Kato M., et al., 2007, Structure 15: 992-1004.
  • Size / Price
    Catalog: HG12312-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"