After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
KIAA0101cDNA Clone Product Information
cDNA Size:336
cDNA Description:ORF Clone of Homo sapiens platelet-activating factor DNA.
Gene Synonym:L5, PAF, OEATC1, NS5ATP9, OEATC-1, p15(PAF), KIAA0101
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10997-ACG$325
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10997-ACR$325
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10997-ANG$325
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10997-ANR$325
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10997-CF$295
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10997-CH$295
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10997-CM$295
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10997-CY$295
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone)HG10997-M$95
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10997-M-F$295
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10997-M-N$295
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10997-NF$295
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10997-NH$295
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10997-NM$295
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10997-NY$295
Human PAF / KIAA0101 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10997-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

KIAA0101, also known as p15(PAF), is a proliferating cell nuclear antigen-associated factor which interacts with proliferating cell nuclear antigen(PCNA). It was initially isolated in a yeast two-hybrid screen for PCNA binding partners, and was shown to bind PCNA competitively with the cell cycle regulator p21(WAF). KIAA0101 is localized primarily in the nucleus. It shares the conserved PCNA binding motif with several other PCNA binding proteins including CDK inhibitor p21 . KIAA0101 is involved in cell proliferation and plays a role in early tumor recurrence (ETR), and prognosis of hepatocellular carcinoma (HCC). KIAA0101 is expressed predominantly in liver, pancreas and placenta. It cannot be detected in heart or brain. It is highly expressed in a number of tumors, especially esophageal tumors, in anaplastic thyroid carcinomas and in non-small-cell lung cancer lines. Overexpression of KIAA0101 predicts high stage, early tumor recurrence, and poor prognosis of hepatocellular carcinoma. It also may be involved in protection of cells from UV-induced cell death.

  • Yu P, et al. (2001) p15(PAF), a novel PCNA associated factor with increased expression in tumor tissues. Oncogene. 20 (4): 484-9.
  • Simpson F, et al. (2005) The PCNA-associated factor KIAA0101/p15(PAF) binds the potential tumor suppressor product p33ING1b. Exp Cell Res. 312 (1): 73-85.
  • Guo M, et al. (2006) KIAA0101 (OEACT-1), an expressionally down-regulated and growth-inhibitory gene in human hepatocellular carcinoma. BMC Cancer. 6: 109.
  • Nagase T, et al. (1995) Prediction of the coding sequences of unidentified human genes. III. The coding sequences of 40 new genes (KIAA0081-KIAA0120) deduced by analysis of cDNA clones from human cell line KG-1. DNA Res. 2 (1): 37-43.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items