After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PCSK1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PCSK1 cDNA Clone Product Information
Gene_bank_ref_id:NM_000439.4
RefSeq ORF Size:2262bp
cDNA Description:Full length Clone DNA of Homo sapiens proprotein convertase subtilisin/kexin type 1 with C terminal HA tag.
Gene Synonym:PC1, PC3, NEC1, SPC3, BMIQ12, PCSK1
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Neuroendocrine convertase 1, also known as Prohormone convertase 1, Proprotein convertase 1, PCSK1 and NEC1, is an enzyme which belongs to the peptidase S8 family and Furin subfamily. PCSK1 is an enzyme that performs the proteolytic cleavage of prohormones to their intermediate (or sometimes completely cleaved) forms. It is present only in neuroendocrine cells such as brain, pituitary and adrenal, and most often cleaves after a pair of basic residues within prohormones but can occasionally cleave after a single arginine. It binds to a protein known as proSAAS, which also represents its endogenous inhibitor. PCSK1 is involved in the processing of hormone and other protein precursors at sites comprised of pairs of basic amino acid residues. PCSK1 substrates include POMC, renin, enkephalin, dynorphin, somatostatin and insulin. Defects in PCSK1 are the cause of proprotein convertase 1 deficiency (PC1 deficiency). PC1 deficiency is characterized by obesity, hypogonadism, hypoadrenalism, reactive hypoglycemia as well as marked small-intestinal absorptive dysfunction. It is due to impaired processing of prohormones.

References
  • Jackson RS. et al., 2003, J. Clin. Invest. 112:1550-60.
  • Farooqi I.S. et al., 2007, J. Clin. Endocrinol. Metab. 92: 3369-73.
  • Benzinou,M. et al., 2008,Nat Genet. 40 (8):943-5.
  • Benzinou M. et al., 2008, Nat. Genet. 40:943-5.
  • Renström F, et al., 2009, Hum. Mol. Genet. 18 (8): 1489-96.
  • Size / Price
    Catalog: HG10129-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"