After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DUSP3cDNA Clone Product Information
cDNA Size:558
cDNA Description:ORF Clone of Homo sapiens dual specificity phosphatase 3 DNA.
Gene Synonym:DUSP3, VHR
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10114-ACG$325
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10114-ACR$325
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10114-ANG$325
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10114-ANR$325
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10114-CF$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10114-CH$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10114-CM$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10114-CY$295
Human VHR Gene cDNA Clone (full-length ORF Clone)HG10114-M$95
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10114-M-F$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10114-M-N$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10114-NF$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10114-NH$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10114-NM$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10114-NY$295
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10114-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Vaccinia H1-related phosphatase (VHR) is classified as a dual-specificity phosphatase (DUSP), and the other name is dual-specificity phosphatase 3 (DUSP3). DUSPs are a heterogeneous group of protein phosphatases that can dephosphorylate both phosphotyrosine and phosphoserine/phosphothreonine residues within the one substrate. Unlike typical DUSPs, VHR lacks mitogen-activated protein kinase (MAPK)-binding domain, and shows poor activity against MAPKs. VHR often act on bisphosphorylated protein substrates, it displays a strong preference for dephosphorylating phosphotyrosine residues over phosphothreonine residues. VHR has been identified as a novel regulator of extracellular regulated kinases (ERKs). VHR is responsible for the rapid inactivation of ERK following stimulation and for its repression in quiescent cells. VHR is a negative regulator of the Erk and Jnk pathways in T cells and, therefore, may play a role in aspects of T lymphocyte physiology that depend on these kinases.

  • Todd J.L, et al. (1999) Extracellular regulated kinases (ERK) 1 and ERK2 are authentic substrates for the dual-specificity protein-tyrosine phosphatase VHR. A novel role in down-regulating the ERK pathway. J. Biol. Chem. 274: 13271-80.
  • Alonso A, et al. (2001) Inhibitory role for dual specificity phosphatase VHR in T cell antigen receptor and CD28-induced Erk and Jnk activation. J Biol Chem. 276(7): 4766-71.
  • Schumacher MA, et al. (2002) Structural basis for the recognition of a bisphosphorylated MAP kinase peptide by human VHR protein Phosphatase. Biochemistry. 41(9): 3009-17.
  • Patterson KI, et al. (2009) Dual-specificity phosphatases: critical regulators with diverse cellular targets. Biochem J. 2009 Mar 15;418(3): 475-89.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items