Quick Order

Human ACO1 / IREB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ACO1cDNA Clone Product Information
cDNA Size:2670
cDNA Description:ORF Clone of Homo sapiens aconitase 1, soluble DNA.
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human ACO1 / IREB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human ACO1 / IREB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10966-ACG$425
Human ACO1 / IREB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10966-ACR$425
Human ACO1 / IREB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10966-ANG$425
Human ACO1 / IREB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10966-ANR$425
Human ACO1 / IREB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10966-CF$395
Human ACO1 / IREB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10966-CH$395
Human ACO1 / IREB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10966-CM$395
Human ACO1 / IREB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10966-CY$395
Human ACO1 / IREB1 Gene cDNA Clone (full-length ORF Clone)HG10966-M$145
Human ACO1 / IREB1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10966-M-F$395
Human ACO1 / IREB1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10966-M-N$395
Human ACO1 / IREB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10966-NF$395
Human ACO1 / IREB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10966-NH$395
Human ACO1 / IREB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10966-NM$395
Human ACO1 / IREB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10966-NY$395
Human ACO1 / IREB1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10966-UT$395
 Learn more about expression Vectors
Related Products
Product nameProduct name

Aconitase 1(ACO1) or IRP1 is one member of the aconitase family that contains a diverse group of iron-sulphur(Fe-S) isomerases and two types of iron regulatory protein. Aconitase exits in two forms: one is soluble and the other is mitochondrial. ACO1 is the soluble existing form, and the mitochondrial form is ACO2. Residues from all three N-terminal domains and the larger C-terminal domain contribute to the active site region. When the enzyme is activated, it gains an additional iron atom. ACO1 can assume two different functions in cells, depending on different conditions. During iron scarcity or oxidative stress, ACO1 binds to mRNA stem-loop structures called iron responsive elements to modulate the translation of iron metabolism genes. In iron-rich conditions, ACO1 binds an iron-sulfur cluster to function as a cytosolic aconitase. 

  • Robbins AH, et al. (1989) The structure of aconitase. Proteins: Structure, Function, and Bioinformatics. 5 (4): 289-312.
  • Volz K. (2008) The functional duality of iron regulatory protein 1. Curr Opin Struct Biol. 18 (1): 106-11.
  • Gruer MJ, et al. (1997) The aconitase family: three structural variations on a common theme. Trends Biochem Sci. 22 (1): 3-6.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items