Quick Order

Text Size:AAA

Human ACO2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ACO2 cDNA Clone Product Information
Gene_bank_ref_id:NM_001098.2
RefSeq ORF Size:2343bp
cDNA Description:Full length Clone DNA of Homo sapiens aconitase 2, mitochondrial with N terminal His tag.
Gene Synonym:ACONM, MGC20605, MGC33908,
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Robbins AH, et al. (1989) The structure of aconitase. Proteins. 5 (4): 289-312.
  • Lauble H, et al. (1992) Crystal structures of aconitase with isocitrate and nitroisocitrate bound. Biochemistry. 31 (10): 2735-48.
  • Robbins AH, et al. (1989) Structure of activated aconitase: formation of the 4Fe-4S cluster in the crystal. Proc Natl Acad Sci. 86 (10): 3639-43.
  • Size / Price
    Catalog: HG10958-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"