Quick Order

Human CLIC4 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CLIC4 cDNA Clone Product Information
NCBI RefSeq:BC012444
RefSeq ORF Size:762bp
cDNA Description:Full length Clone DNA of Homo sapiens chloride intracellular channel 4 with C terminal His tag.
Gene Synonym:H1, huH1, p64H1, CLIC4L, MTCLIC, CLIC4
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Chloride intracellular channel protein 4, also known as Intracellular chloride ion channel protein p64H1 and CLIC4, is a member of the chloride channel CLIC family. It contains one GST C-terminal domain. CLIC4 is a member of a family of intracellular chloride channels. It is regulated by p53, c-Myc, and tumor necrosis factor-alpha. CLIC4 is detected in epithelial cells from colon, esophagus and kidney (at protein level). CLIC4 has alternate cellular functions like a potential role in angiogenesis or in maintaining apical-basolateral membrane polarity during mitosis and cytokinesis. CLIC4 could promote endothelial cell proliferation and regulate endothelial morphogenesis (tubulogenesis). Expression of CLIC4 is prominent in heart, kidney, placenta and skeletal muscle. Overexpression of CLIC4 in cancer cells inhibits tumor growth. Conversely, overexpression of CLIC4 in tumor stromal cells stimulates tumor growth. Thus, CLIC4 participates in normal and pathological processes and may serve as a useful target for therapies in disturbances of homeostasis and neoplastic transformation. Loss of CLIC4 in tumor cells and gain in tumor stroma is common to many human cancers and marks malignant progression. Up-regulation of CLIC4 in tumor stroma is coincident with myofibroblast conversion, generally a poor prognostic indicator. Reactivation and restoration of CLIC4 in tumor cells or the converse in tumor stromal cells could provide a novel approach to inhibit tumor growth.

References
  • Ronnov-Jessen L., et al., 2002, Am. J. Pathol. 161:471-480.
  • Berryman M.A., et al., 2003, Cell Motil. Cytoskeleton 56:159-172.
  • Suh,K.S. et al., 2005, J Investig Dermatol Symp Proc. 10 (2):105-9.
  • Suh,K.S. et al., 2007, Mol Carcinog.46 (8):599-604.
  • Suh,K.S. et al., 2007, J Cell Sci  120 (Pt 15):2631-40.
  • Suh,K.S. et al., 2007, Clin Cancer Res  13 (1):121-31.
  • Size / Price
    Catalog: HG12271-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"