Quick Order

Human MMP-2 transcript variant 1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MMP2 cDNA Clone Product Information
Gene_bank_ref_id:NM_004530.4
RefSeq ORF Size:1983bp
cDNA Description:Full length Clone DNA of Homo sapiens matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type I V collagenase), transcript variant 1 with C terminal HA tag.
Gene Synonym:MMP2, CLG4, MONA, CLG4A, TBE-1, MMP-II
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Matrix Metalloproteinase-2 (MMP-2) is an enzyme that degrades components of the extracellular matrix and thus plays a pivotal role in cell migration during physiological and pathological processes. MMP-2 expression is dependent on extracellular matrix metalloproteinase inducer (EMMPRIN), Her2/neu, growth factors, cytokines, and hormones. Pro-MMP-2 activation needs MT1-MMP and TIMP-2 contribution. MMP-2 is changed in distribution and increased in amount in the ventral cochlear nucleus after unilateral cochlear ablation. A low level of MMP-2 is linked to favorable prognosis in patients with a hormone receptor-negative tumor, usually associated with high risk. As a zymogen requiring proteolytic activation for catalytic activity, MMP-2 has been implicated broadly in the invasion and metastasis of many cancer model systems, including human breast cancer (HBC). Blocking MMP-2 secretion and activation during breast carcinoma development may decrease metastasis. The detection of active MMP-2 alone or the rate of pro-MMP-2 and active MMP-2 is considered a very sensitive indicator of cancer metastasis. Modulation of MMP-2 expression and activation through specific inhibitors and activators may thus provide a new mechanism for breast cancer treatment.

References
  • Thompson EW, et al. (1994) Collagen induced MMP-2 activation in human breast cancer. Breast Cancer Res Treat. 31(2-3): 357-70.
  • Jezierska A, et al. (2009) Matrix metalloproteinase-2 involvement in breast cancer progression: a mini-review. Med Sci Monit. 15(2): RA32-40.
  • Fredrich M, et al. (2010) MMP-2 is involved in synaptic remodeling after cochlear lesion. Neuroreport. 21(5): 324-7.
  • Size / Price
    Catalog: HG10082-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"