Quick Order

Human KRAS Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
KRAScDNA Clone Product Information
cDNA Size:567
cDNA Description:ORF Clone of Homo sapiens v-Ki-ras2 Kirsten rat sarcoma viral oncogene homol DNA.
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

K-Ras belongs to the small GTPase superfamily, Ras family. As other members of the Ras family, K-Ras is a GTPase and is an early player in many signal transduction pathways. It is usually tethered to cell membranes because of the presence of an isoprenyl group on its C-terminus. K-Ras functions as a molecular on/off switch. Once it is turned on it recruits and activates proteins necessary for the propagation of growth factor and other receptors' signal, such as c-Raf and PI 3-kinase. It binds to GTP in the active state and possesses an intrinsic enzymatic activity which cleaves the terminal phosphate of the nucleotide converting it to GDP. Upon conversion of GTP to GDP, K-Ras is turned off. The rate of conversion is usually slow but can be sped up dramatically by an accessory protein of the GTPase activating protein class, for example RasGAP. In turn K-Ras can bind to proteins of the Guanine Nucleotide Exchange Factor class, for example SOS1, which forces the release of bound nucleotide. Subsequently, K-Ras binds GTP present in the cytosol and the GEF is released from ras-GTP. Besides essential function in normal tissue signaling, the mutation of a K-Ras gene is an essential step in the development of many cancers. Several germline K-Ras mutations have been found to be associated with Noonan syndrome[4] and cardio-facio-cutaneous syndrome. Somatic K-Ras mutations are found at high rates in Leukemias, colon cancer, pancreatic cancer and lung cancer.

  • Ling J, et al. (2012) KrasG12D-induced IKK2//NF-B activation by IL-1 alpha and p62 feedforward loops is required for development of pancreatic ductal adenocarcinoma. Cancer Cell. 21(1):105-20.
  • Matallanas D, et al. (2011) Mutant K-Ras activation of the proapoptotic MST2 pathway is antagonized by wild-type K-Ras. Mol Cell. 44(6):893-906.
  • Regala RP, et al. (2011) Matrix metalloproteinase-10 promotes Kras-mediated bronchio-alveolar stem cell expansion and lung cancer formation. PLoS One. 6(10):e26439.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items