Quick Order

Text Size:AAA

Human CREB1 transcript variant A ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CREB1 cDNA Clone Product Information
Gene_bank_ref_id:NM_004379.2
RefSeq ORF Size:984bp
cDNA Description:Full length Clone DNA of Homo sapiens cAMP responsive element binding protein 1, transcript variant A with C terminal HA tag.
Gene Synonym:CREB1, CREB, MGC9284
Species:Human
Vector:pCMV3-C-HA
Plasmid:pCMV3-CREB1-HA
Restriction Site:HindIII + XbaI (6kb + 1.03kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CAMP responsive element binding protein 1, also known as CREB-1, plays multiple functions as a transcription factor in gene regulation. This protein is a CREB transcription factor that is a member of the leucine zipper family of DNA-binding proteins. CREB1 proteins are also known to be expressed in several spliced isoforms that act as transcriptional activators or repressors. The activator isoforms, possessing the functional domains for kinase induction and for interaction with other transcriptional regulators, act as transcriptional activators.The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. CREB-1 has a complex influence on behavioural responses to drugs of abuse which varies depending on the brain region in which it is expressed. CREB-1 is important for serotonin (5-HT)-induced long-term facilitation (LTF) of the sensorimotor synapse in Aplysia. 

References
  • Sadamoto H, et al. (2011) Direct observation of dimerization between different CREB1 isoforms in a living cell. PLoS One. 6 (6): e20285.
  • Liu RY, et al. (2011) The requirement for enhanced CREB1 expression in consolidation of long-term synaptic facilitation and long-term excitability in sensory neurons of Aplysia. J Neurosci. 31 (18): 6871-9.
  • Hoeffler JP, et al. (1988) Cyclic AMP-responsive DNA-binding protein: structure based on a cloned placental cDNA. Science. 242 (4884): 1430-3.
  • Size / Price
    Catalog: HG10074-CY
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"