Quick Order

Human CAMKV Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CAMKVcDNA Clone Product Information
cDNA Size:1506
cDNA Description:ORF Clone of Homo sapiens CaM kinase-like vesicle-associated DNA.
Gene Synonym:1G5, VACAMKL, CAMKV
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

CaM kinase-like vesicle-associated protein, also known as CAMKV, is a peripheral membrane protein and Cytoplasmic vesicle membrane protein which belongs to the protein kinase superfamily and CAMK Ser/Thr protein kinase family. CAMKV contains one protein kinase domain. It is predominantly observed in association with the plasma membrane of soma and in neurites, both axons and dendrites. CAMKV may be associated with vesicular structures. It does not appear to have detectable kinase activity.

Protein kinases are a group of enzymes that move a phosphate group onto proteins, in a process called phosphorylation. Protein kinases function as an on/off switch for many cellular processes, including metabolism, transcription, cell cycle progression, cytoskeletal rearrangement and cell movement, apoptosis, and differentiation. They also function in embryonic development, physiological responses, and in the nervous and immune system. Abnormal phosphorylation causes many human diseases, including cancer, and drugs that affect phosphorylation can treat those diseases. The protein kinase domain is a structurally conserved protein domain containing the catalytic function of protein kinases. Protein kinases play a role in a mulititude of cellular processes, including division, proliferation, apoptosis, and differentiation. Phosphorylation usually results in a functional change of the target protein by changing enzyme activity, cellular location, or association with other proteins.

  • Hunter T, et al.,1988, Science. 241 (4861): 42-51.
  • Wiemann S., et al., 2001, Genome Res. 11:422-435.
  • G. Manning, et al., 2002, Science 6. 298:1912-1934.
  • Manning G, et al.,2002, Science. 298 (5600): 1912-34.
  • Ota T., et al., 2004, Nat. Genet. 36:40-45.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items