Quick Order

Human SIGLEC6 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SIGLEC6 cDNA Clone Product Information
NCBI RefSeq:BC035359
RefSeq ORF Size:1281bp
cDNA Description:Full length Clone DNA of Homo sapiens sialic acid binding Ig-like lectin 6 with C terminal His tag.
Gene Synonym:CD327, CD33L, OBBP1, CD33L1, CD33L2, CDW327, SIGLEC6
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

SIGLEC6, also known as CD327, belongs to the immunoglobulin superfamily, SIGLEC (sialic acid binding Ig-like lectin) family. SIGLEC6 is a sialic acid recognizing protein expressed at high levels in placenta (cyto- and syncytiotrophoblastic cells) and at lower levels in spleen, peripheral blood leukocytes (predominantly B-cells) and small intestine. SIGLEC6 localizes in various compartments such as membrane fraction, extracellular region and so on. SIGLEC6 may show increasing expression human labor and following childbirth, it has been speculated that this expression helps to slow the tempo of human labor.  Interestingly, expression of SIGLEC6 is further upregulated in pre-eclampsia, which appears to be a uniquely human disease.

References
  • Winn VD. et al., 2009, Endocrinology. 150 (1): 452-62.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Lam KK. et al., 2011, J Biol Chem. 286 (43): 37118-27.
  • Size / Price
    Catalog: HG12241-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"