After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PARVA ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PARVA cDNA Clone Product Information
Gene_bank_ref_id:BC016713
RefSeq ORF Size:1119bp
cDNA Description:Full length Clone DNA of Homo sapiens parvin, alpha with N terminal Myc tag.
Gene Synonym:MXRA2, CH-ILKBP
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Actopaxin, also known as alpha-parvin, belongs to the parvin family. It is widely expressed, with highest levels in heart, skeletal muscle, kidney and liver. Actopaxin contains 2 CH (calponin-homology) domains and probably plays a role in the regulation of cell adhesion and cytoskeleton organization. It interacts with integrin-linked protein kinase and probably with actin and the LD1 and LD4 motifs of PXN. Actopaxin binds directly to both F-actin and paxillin LD1 and LD4 motifs. Actopaxin also exhibits robust focal adhesion localization in several cultured cell types but is not found along the length of the associated actin-rich stress fibers. It is absent from actin-rich cell-cell adherens junctions.

References
  • Korenbaum E, et al. (2002) Genomic organization and expression profile of the parvin family of focal adhesion proteins in mice and humans. Gene. 279(1):69-79.
  • Nikolopoulos SN, et al. (2002) Molecular dissection of actopaxin-integrin-linked kinase-Paxillin interactions and their role in subcellular localization. J Biol Chem. 277(2): 1568-75.
  • Tu Y, et al. (2001) A new focal adhesion protein that interacts with integrin-linked kinase and regulates cell adhesion and spreading. J Cell Biol. 153(3): 585-98.
  • Size / Price
    Catalog: HG13919-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"