Quick Order

Human ABHD14B ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ABHD14B cDNA Clone Product Information
NCBI RefSeq:BC007234
RefSeq ORF Size:633bp
cDNA Description:Full length Clone DNA of Homo sapiens abhydrolase domain containing 14B with N terminal Myc tag.
Gene Synonym:CIB
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

ABHD14B belongs to the AB hydrolase superfamily, ABHD14 family. It can be detected in spleen, thymus, prostate, testis, ovary, small intestine, colon, peripheral blood leukocyte, heart, placenta, lung, liver, skeletal muscle, pancreas and kidney. ABHD14B has hydrolase activity towards p-nitrophenyl butyrate (in vitro) and may interact with TAF1. It may activate transcription. Recombinant human ABHD14B protein, fused to His-tag at N-terminus, was expressed in E.coli and purified by using conventional chromatography techniques. ABHD14B contains an alpha/beta hydrolase fold, which is a catalytic domain found in a very wide range of enzymes. In molecular biology, the alpha/beta hydrolase fold is common to a number of hydrolytic enzymes of widely differing phylogenetic origin and catalytic function. The Ab hydrolase domain containing gene subfamily is comprised of 15 mostly uncharacterized members.

References
  • Mehrle A, et al. (2006) The LIFEdb database in 2006. Nucleic Acids Res. 34:D415-8.
  • Wan D, et al. (2004) Large-scale cDNA transfection screening for genes related to cancer development and progression. Proc Natl Acad Sci. 101(44):15724-9.
  • Wiemann S, et al. (2004) From ORFeome to biology: a functional genomics pipeline. Genome Res. 14 (10B):2136-44.
  • Size / Price
    Catalog: HG13913-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"