After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human TIGIT / VSTM3 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TIGIT cDNA Clone Product Information
Gene_bank_ref_id:NM_173799.2
RefSeq ORF Size:735bp
cDNA Description:Full length Clone DNA of Homo sapiens T cell immunoreceptor with Ig and ITIM domains with N terminal His tag.
Gene Synonym:VSIG9, VSTM3, FLJ39873, DKFZp667A205
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-TIGIT
Restriction Site:KpnI + XbaI (6kb + 0.77kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 309T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human TIGIT Gene Plasmid Map
Human TIGIT / VSTM3 natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

TIGIT, also known as V-set and transmembrane domain-containing protein 3 (VSTM3) or V-set and immunoglobulin domain-containing protein 9 (VSIG9) is a new surface protein containing an immunoglobulin variable domain, a transmembrane domain and an immunoreceptor tyrosine-based inhibitory motif (ITIM). TIGIT is expressed on regulatory, memory, activated T cells and NK cells. It binds PVR with high affinity, and PVRL2 with lower affinity, but not PVRL3. Knockdown of TIGIT with siRNA in human memory T cells did not affect T cell responses, however, TIGIT inhibits NK cytotoxicity directly through its ITIM. TIGIT suppresses T cell activation by promoting the generation of mature immunoregulatory dendritic cells. The binding of PVR to TIGIT on human dendritic cells enhanced the production of IL-10 and diminished the production of IL-12p40. In addition, TIGIT counter inhibits the NK-mediated killing of tumor cells and protects normal cells from NK-mediated cytotoxicity thus providing an "alternative self" mechanism for MHC class I inhibition.

Size / Price
Catalog: HG10917-NH
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"