After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human DYDC2 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DYDC2 cDNA Clone Product Information
Gene_bank_ref_id:BC007374
RefSeq ORF Size:534bp
cDNA Description:Full length Clone DNA of Homo sapiens DPY30 domain containing 2 with N terminal Myc tag.
Gene Synonym:DYDC2
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

DPY30 domain containing 2 belongs to the dpy-30 family. Dumpy-30 family members act as determinants of male fertility and interaction partners of metal-responsive transcription factor 1 (MTF-1) in Drosophila. MTF-1 plays a key role in transition metal detoxification and homeostasis. It binds to metal response elements (MREs). Two candidate dMTF-1 interactors are related to the small regulatory protein Dumpy-30 (Dpy-30) of the worm C. elegans. Dpy-30 is the founding member of a protein family involved in chromatin modifications, notably histone methylation. Mutants affect mating type in yeast and male mating in C. elegans. As part of the MLL1/MLL complex, DPY30 domain containing 2 is involved in methylation and dimethylation at 'Lys-4' of histone H3. H3 'Lys-4' methylation represents a specific tag for epigenetic transcriptional activation. DPY30 domain containing 2 may also play an indirect or direct role in endosomal transport.

References
  • 1. Deloukas P, et al. (2004) The DNA sequence and comparative analysis of human chromosome 10. Nature. 429(6990):375-81.
  • 2. Rual JF, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • 3. Xin X, et al. (2009) Shifted Transversal Design smart-pooling for high coverage interactome mapping. Genome Res. 19(7):1262-9.
  • Size / Price
    Catalog: HG13911-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"