Quick Order

Text Size:AAA

Human BPI Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BPIcDNA Clone Product Information
cDNA Size:1464
cDNA Description:ORF Clone of Homo sapiens bactericidal/permeability-increasing protein DNA.
Gene Synonym:rBPI, BPIFD1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Bactericidal/permeability-increasing protein is a member of the BPI/LBP/Plunc superfamily and BPI/LBP family. It is a cationic protein which can be detected in the azurophilic granule and on the surface of polymorphonuclear leukocytes. Bactericidal/permeability-increasing protein also is a lipopolysaccharide binding protein. It is associated with human neutrophil granules and has bactericidal activity on gram-negative organisms. Bactericidal/permeability-increasing protein contains two domains that adopt the same structural fold, even though they have little sequence similarity. It binds to and neutralises lipopolysaccharides from the outer membrane of Gram-negative bacteria. The cytotoxic action of bactericidal/permeability-increasing protein is limited to many species of Gram-negative bacteria; this specificity may be explained by a strong affinity of the very basic N-terminal half for the negatively charged lipopolysaccharides that are unique to the Gram-negative bacterial outer envelope.

  • G Schlag, et al. (1999) Protective effect of bactericidal/permeability-increasing protein (rBPI21) in baboon sepsis is related to its antibacterial, not antiendotoxin, properties. Annals of Surgery. 229(2): 262-71.
  • Michael Levin, et al. (2000) Recombinant bactericidal/permeability-increasing protein (rBPI21) as adjunctive treatment for children with severe meningococcal sepsis: a randomised trial. Lancet. 356 (9234):961-7.
  • Geraldine Canny, et al. (2002) Lipid mediator-induced expression of bactericidal/ permeability-increasing protein (BPI) in human mucosal epithelia. PNAS. 99(6):3902-7.
  • Elsbach, et al. (1998) The bactericidal/permeability-increasing protein (BPI) in antibacterial host defense (pdf). Journal of Leukocyte biology. 64(1):14-8.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items