Quick Order

Human Lck Kinase transcript variant 1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LCK cDNA Clone Product Information
Gene_bank_ref_id:NM_001042771.1
RefSeq ORF Size:1530bp
cDNA Description:Full length Clone DNA of Homo sapiens lymphocyte-specific proteintyrosine kinase (LCK), transcript variant 1 with C terminal HA tag.
Gene Synonym:LCK, YT16, p56lck, pp58lck
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human Lck Kinase transcript variant 1 ORF mammalian expression plasmid, C-HA tag on other vectors
Product nameProduct name
Background

Protein kinases are critically involved in signaling pathways that regulate cell growth, differentiation, activation, and survival. Initially identified as a T-cell specific member of the Src family of protein tyrosine kinases, Lck has become the object of intensive investigations which have revealed a key role for this kinase in the central processes controlling T-cell development, activation, proliferation and survival. Lck is expressed specifically in lymphoid cells. It contains one protein kinase domain, one SH2 domain, and one SH3 domain. It is associated with a variety of cell surface receptors and is critical for signal transduction from the T-cell antigen receptor (TCR). Consequently, Lck is targeted by regulatory proteins of T-lymphotropic viruses, especially by the Herpesvirus saimiri (HVS) tyrosine kinase interacting protein (Tip). This oncoprotein physically interacts with Lck in HVS transformed T cells and has an impact on its catalytic activity. Together with the identification of defects in the regulation of Lck expression or activity in T-cell leukemias, suggests that dysregulation of Lck might play a role in neoplastic transformation. However, under certain conditions Lck is also involved in the induction of apoptosis. This chemosensitizing effect of Lck is independent of T-cell receptor signaling and does not require the kinase activity of Lck. The findings demonstrate that Lck might be part of two independent signaling pathways leading to either cell proliferation or apoptosis.

References
  • Majolini MB, et al. (1999) Dysregulation of the protein tyrosine kinase LCK in lymphoproliferative disorders and in other neoplasias. Leuk Lymphoma. 35(3-4): 245-54.
  • Isakov N, et al. (2000) Lck protein tyrosine kinase is a key regulator of T-cell activation and a target for signal intervention by Herpesvirus saimiri and other viral gene products. Eur J Biochem. 267(12): 3413-21.
  • Heyninck K, et al. (2006) A novel link between Lck, Bak expression and chemosensitivity. Oncogene. 25(12): 1693-5.
  • Size / Price
    Catalog: HG10043-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"