Quick Order

Text Size:AAA

Human SCN3B Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SCN3BcDNA Clone Product Information
Gene_bank_ref_id:BC117282
cDNA Size:648
cDNA Description:ORF Clone of Homo sapiens sodium channel, voltage-gated, type III, beta DNA.
Gene Synonym:HSA243396, SCNB3, SCN3B
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

SCN3B (sodium channel, voltage-gated, type III, beta ,human IgG1-Fc chimera) belongs to the sodium channel auxiliary subunit SCN3B family. It contains 1 Ig-like C2-type (immunoglobulin-like) domain. Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. SCN3B gene encodes one member of the sodium channel beta subunit gene family, and influences the inactivation kinetics of the sodium channel. Two alternatively spliced variants, encoding the same protein, have been identified. Defects in SCN3B are the cause of Brugada syndrome type 7. A tachyarrhythmia characterized by right bundle branch block and ST segment elevation on an electrocardiogram. It can cause the ventricles to beat so fast that the blood is prevented from circulating efficiently in the body. When this situation occurs (called ventricular fibrillation), the individual will faint and may die in a few minutes if the heart is not reset.

References
  • Morgan K, et al. (2000) _3: An additional auxiliary subunit of the voltage-sensitive sodium channel that modulates channel gating with distinct kinetics. Proc Natl Acad Sci. 97(5):2308-13.
  • Hartley JL, et al. (2001) DNA Cloning Using In Vitro Site-Specific Recombination. Genome Res. 10(11): 1788-95.
  • Hirosawa M, et al. (2000) Characterization of cDNA clones selected by the GeneMark analysis from size-fractionated cDNA libraries from human brain. DNA Res. 6(5):329-36.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"