After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human ECE-1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ECE1cDNA Clone Product Information
Gene_bank_ref_id:NM_001397.2
cDNA Size:2313
cDNA Description:ORF Clone of Homo sapiens endothelin converting enzyme 1 DNA.
Gene Synonym:ECE, ECE1
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Endothelin-converting enzyme 1, also known as ECE-1, is a single-pass type I I membrane protein which belongs to the peptidase M13 family. ECE-1 converts big endothelin-1 to endothelin-1. ECE-1 is a membrane metalloprotease that generates endothelin from its direct precursor big endothelin. Four isoforms of ECE-1 are produced from a single gene through the use of alternate promoters. These isoforms share the same extracellular catalytic domain and contain unique cytosolic tails, which results in their specific subcellular targeting.All isoforms of ECE-1 are expressed in umbilical vein endothelial cells, polynuclear neutrophils, fibroblasts, atrium cardiomyocytes and ventricles. Isoforms A, B and C of ECE-1 are also expressed in placenta, lung, heart, adrenal gland and phaeochromocytoma; isoforms A and C of ECE-1 in liver, testis and small intestine; isoform B, C and D of ECE-1 in endothelial cells and umbilical vein smooth muscle cells; isoforms C and D in saphenous vein cells, and isoform C in kidney. Defects in ECE1 are a cause of Hirschsprung disease, cardiac defects and autonomic dysfunction. It is a form of Hirschsprung disease with skip-lesions defects, craniofacial abnormalities and other dysmorphic features, and autonomic dysfunction.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"