After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PLA2G1B Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PLA2G1BcDNA Clone Product Information
cDNA Size:447
cDNA Description:ORF Clone of Homo sapiens phospholipase A2, group IB (pancreas) DNA.
Gene Synonym:RLF, RLNL, MGC119818, MGC119819, INSL3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Mouse phospholipase A2, also known as Phosphatidylcholine 2-acylhydrolase 1B, Group IB phospholipase A2, PLA2 and PLA2G1B, is a secreted protein which belongs to the phospholipase A2 family. Phospholipase A2 / PLA2G1B catalyzes the release of fatty acids from glycero-3-phosphocholines. The best known varieties are the digestive enzymes secreted as zymogens by the pancreas of mammals. Sequences of pancreatic Phospholipase A2 / PLA2G1B enzymes from a variety of mammals have been reported. One striking feature of these enzymes is their close homology to venom phospholipases of snakes. Other forms of Phospholipase A2 / PLA2G1B have been isolated from brain, liver, lung, spleen, intestine, macrophages, leukocytes, erythrocytes, inflammatory exudates, chondrocytes, and platelets. Mice lacking in Phospholipase A2 / PLA2G1B are resistant to obesity and diabetes induced by feeding a diabetogenic high-fat/high-carbohydrate diet. Oral supplementation of a diabetogenic diet with the PLA2G1B inhibitor methyl indoxam effectively suppresses diet-induced obesity and diabetes. PLA2G1B inhibition may be a potentially effective oral therapeutic option for treatment of obesity and diabetes.

  • Labonté,E.D. et al., 2006, Diabetes. 55 (4) :935-41.
  • Mounier,C.M. et al.,2008, Br J Cancer. 98 (3):587-95.
  • Hui,D.Y. et al., 2009, Br J Pharmacol. 157 (7):1263-9.
  • Labonté,E.D. et al., 2010, FASEB J. 24 (7):2516-24.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items