Quick Order

Human TIMD4 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TIMD4 cDNA Clone Product Information
Gene_bank_ref_id:BC008988
RefSeq ORF Size:1137bp
cDNA Description:Full length Clone DNA of Homo sapiens T-cell immunoglobulin and mucin domain containing with C terminal His tag.
Gene Synonym:TIM4, FLJ27515, SMUCKLER, TIMD4
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

A type I transmembrane protein called TIM4 (T-cell immunoglobulin- and mucin-domain-containing molecule; also known as TIMD4), which belongs to the immunoglobulin superfamily and TIM family. TIM4 is involved in regulating T-cell proliferation and lymphotoxin signaling. It is a ligand for HAVCR1/TIMD1. Recent reports indicate that dendritic cell (DC)-derived T-cell immunoglobulin and mucin domain molecule (TIM)-4, which is expressed on dendritic cells and macrophages, plays an important role in the initiation of T(H)2 polarization. TIM4 bound apoptotic cells by recognizing phosphatidylserine via its immunoglobulin domain. The expression of TIM4 in fibroblasts enhanced their ability to engulf apoptotic cells. TIM4 is phosphatidylserine receptor for the engulfment of apoptotic cells, and may also be involved in intercellular signalling in which exosomes are involved. Modulation of TIM4 production in dendritic cells (DCs) represents a novel therapeutic approach for the treatment of peanut allergy. The interaction of TIM1/TIM4 played a critical role in sustaining the polarization status of Th2 cells in allergic rhinitis (AR) patients. Cross-linking FcgammaRI by antigen/IgG complexes increased the production of TIM4 by dendritic cells via upregulating tumor necrosis factor-alpha in DCs. Specific immunotherapy (SIT) suppresses the skewed Th2 responses via disrupting the interaction of TIM1/TIM4 in antigen-specific Th2 cells.

References
  • Miyanishi M, et al. (2007) Identification of Tim4 as a phosphatidylserine receptor. Nature. 450(7168): 435-9.
  • Feng BS, et al. (2008) Disruption of T-cell immunoglobulin and mucin domain molecule (TIM)-1/TIM4 interaction as a therapeutic strategy in a dendritic cell-induced peanut allergy model. J Allergy Clin Immunol. 122(1): 55-61.
  • Cai PC, et al. (2009) Association of TIM4 promoter polymorphism -1419GA with childhood asthma in a Chinese Han population. Tissue Antigens. 74(1): 11-6.
  • Zhao CQ, et al. (2010) Specific immunotherapy suppresses Th2 responses via modulating TIM1/TIM4 interaction on dendritic cells. Allergy. 65(8): 986-95.
  • Size / Price
    Catalog: HG12161-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"