After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ACTA2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ACTA2cDNA Clone Product Information
cDNA Size:1134
cDNA Description:ORF Clone of Homo sapiens actin, alpha 2, smooth muscle, aorta DNA.
Gene Synonym:AAT6, ACTSA, MYMY5, ACTA2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human ACTA2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Related Products
Product nameProduct name

Actins are globular multi-functional proteins which can be detected in all eukaryotic cells. In vertebrates, there are three main groups of actins that possess slightly different functions: alpha, beta, and gamma. The alpha actins, found in muscle tissues, are a major constituent of the contractile apparatus. Beta-actin, found at the expanding edge of cells, uses the projection of its cellular structure as its mean of mobility. Gamma-actin is found in the filaments of stress fibres. ACTA2 is an alpha actin that is found in skeletal muscle. Expression of alpha skeletal, alpha cardiac, alpha vascular, and gamma enteric actins are restricted to specialized muscle cell type. Smooth muscle alpha actin is of further interest because it is one of a few genes whose expression is relatively restricted to vascular smooth muscle cells. Further more, expression of smooth muscle alpha actin is regulated by hormones, cell proliferation, and altered by pathological conditions including oncogenic transformation and atherosclerosis.

  • Ueyama H, et al., 1990, Jinrui Idengaku Zasshi. 35(2): 145-50.
  • Snásel J, et al., 1997, Folia Biol. 42(5): 227-30.
  • Adams LD, et al., 1992, AIDS Res Hum. 8(2): 291-5.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items