Quick Order

Text Size:AAA

Human IL23R Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL23RcDNA Clone Product Information
cDNA Size:684
cDNA Description:ORF Clone of Homo sapiens interleukin 23 receptor DNA.
Gene Synonym:IL23R
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

IL-12 Family & Receptor Related Products
Product nameProduct name
Rat IL23R / IL23 Receptor Protein (ECD, His Tag)Rabbit IL12B / IL-12B Protein (His Tag)Rat IL12B / IL-12B Protein (Fc Tag)Human IL12A / NKSF1 Protein (Fc Tag)Human IL12A / NKSF1 Protein (His Tag)Human IL12B / P40 Protein (Fc Tag)Human IL12B / P40 Protein (His Tag)Human IL27 / Interleukin-27 Protein (His Tag)Human IL27Ra / TCCR / WSX1 Protein (Fc Tag)Human IL-35 (IL12A & IL27B) Protein (Fc Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Human IL6ST / gp130 / CD130 ProteinHuman IL12RB1 / IL12RB / CD212 Protein (His Tag)Human IL23R / IL23 Receptor Protein (Fc Tag)Mouse IL12RB2 / IL12R-beta 2 Protein (His Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Mouse IL12B / IL-12B Protein (Fc Tag)Mouse IL12B / IL-12B Protein (His Tag)Mouse IL12B / IL-12B ProteinCynomolgus / Rhesus IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL27 / Interleukin-27 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Rat gp130 / IL6ST / CD130 Protein (His Tag)Rat IL12B / IL-12B Protein (His Tag)Rat IL23R / IL23 Receptor Protein (Fc Tag)Cynomolgus / Rhesus IL12A / NKSF1 Protein (Fc Tag)Cynomolgus / Rhesus IL23R / IL23 Receptor Protein (Fc Tag) Cynomolgus IL6ST / gp130 Protein (Fc Tag)Cynomolgus IL6ST / gp130 Protein (His Tag)Marmoset IL12B / IL-12B Protein (Fc Tag)Human IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinHuman IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Human IL12A & IL27B Heterodimer Protein

IL23R, also known as IL23 receptor, belongs to the type I cytokine receptor family, Type 2 subfamily. It contains 2 fibronectin type-III domains and is expressed by monocytes, Th1, Th0, NK and dendritic cells. Isoform 1 is specifically expressed in NK cells. IL23R associates with IL12RB1 to form the interleukin-23 receptor. It binds IL23 and mediates T-cells, NK cells and possibly certain macrophage/myeloid cells stimulation probably through activation of the Jak-Stat signaling cascade. IL23 functions in innate and adaptive immunity and may participate in acute response to infection in peripheral tissues. IL23 may be responsible for autoimmune inflammatory diseases and be important for tumorigenesis. Genetic variations in IL23R are associated with inflammatory bowel disease type 17 (IBD17). IBD17 is a chronic, relapsing inflammation of the gastrointestinal tract with a complex etiology. Genetic variations in IL23R also can cause susceptibility to psoriasis type 7.

  • Duerr RH, et al. (2006) A genome-wide association study identifies IL23R as an inflammatory bowel disease gene. Science. 314(5804):1461-3.
  • Cargill M, et al. (2007) A large-scale genetic association study confirms IL12B and leads to the identification of IL23R as psoriasis-risk genes. Am J Hum Genet. 80(2):273-90.
  • Dubinsky MC, et al. (2007) IL-23 receptor (IL-23R) gene protects against pediatric Crohn's disease. Inflamm Bowel Dis. 13(5):511-5.
  • Tremelling M, et al. (2007) IL23R variation determines susceptibility but not disease phenotype in inflammatory bowel disease. Gastroenterology. 132(5):1657-64.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items