Quick Order

Human GPR114 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GPR114cDNA Clone Product Information
Gene_bank_ref_id:NM_153837.1
cDNA Size:1587
cDNA Description:ORF Clone of Homo sapiens G protein-coupled receptor 114 DNA.
Gene Synonym:PGR27, GPR114
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

GPR114 belongs to the G-protein coupled receptor 2 family. Members of this family share a common molecular architecture which consists of seven transmembrane domains, three extracellular loops, three intracellular loops, an amino-terminal extracellular domain and an intracellular carboxyl terminus. It is thought that light acts as the activating stimulus of a G-protein-coupled receptor (GPCR). GPCRs are expected to have molecular function (G-protein coupled receptor activity) and to localize in various compartments (endoplasmic reticulum membrane, plasma membrane, integral to membrane). Family B of the GPCRs is a small but structurally and functionally diverse group of proteins that includes receptors for polypeptide hormones, molecules thought to mediate intercellular interactions at the plasma membrane and a group of Drosophila proteins that regulate stress responses and longevity. GPR114 contains 1 GPS domain. GPR114 gene has been proposed to participate in processes (G-protein coupled receptor protein signaling pathway, neuropeptide signaling pathway).

References
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Bjarnadttir TK, et al. (2005) The human and mouse repertoire of the adhesion family of G-protein-coupled receptors. Genomics. 84(1):23-33.
  • Gerhard DS, et al. (2004) The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC) . Genome Res. 14(10B):2121-7.
  • Size / Price
    Catalog:HG10854-NH
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"