After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human MFG-E8 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MFGE8 cDNA Clone Product Information
Gene_bank_ref_id:NM_005928.1
RefSeq ORF Size:1164bp
cDNA Description:Full length Clone DNA of Homo sapiens milk fat globule-EGF factor 8 protein with N terminal His tag.
Gene Synonym:BA46, SED1, hP47, EDIL1, SPAG10, OAcGD3S, HsT19888, MFGE8
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

MFG-E8, also known as lactadherin and MFGE8, contains 1 EGF-like domain and 2 F5/8 type C domains. It also contains a phosphatidylserine (PS) binding domain, as well as an Arginine-Glycine-Aspartic acid motif, which enables the binding to integrins. It binds PS, which is exposed on the surface of apoptotic cells. MFG-E8 is expressed in mammary epithelial cell surfaces and aortic media. Overexpression of MFG-E8 can be found in several carcinomas. MFG-E8 has an opsonization of the apoptotic cells and binding to integrins on the surface of phagocytic cells. It also mediates the engulfment of the dead cell. MFG-E8 plays an important role in the maintenance of intestinal epithelial homeostasis and the promotion of mucosal healing. It promotes VEGF-dependent neovascularization and contributes to phagocytic removal of apoptotic cells in many tissues. It also binds to phosphatidylserine-enriched cell surfaces in a receptor-independent manner.

References
  • Oshima K, et al. (2002) Secretion of a peripheral membrane protein, MFG-E8, as a complex with membrane vesicles. Eur J Biochem. 269(4):1209-18.
  • Hanayama R, et al. (2002) Identification of a factor that links apoptotic cells to phagocytes. Nature. 417 (6885):182-7.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Size / Price
    Catalog: HG10853-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"