After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PLA2G7 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PLA2G7 cDNA Clone Product Information
Gene_bank_ref_id:NM_005084.3
RefSeq ORF Size:1326bp
cDNA Description:Full length Clone DNA of Homo sapiens phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) with N terminal His tag.
Gene Synonym:PAFAH, LDL-PLA2
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-PLA2G7
Restriction Site:KpnI + XbaI (6kb + 1.36kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PLA2G7 Gene Plasmid Map
Human PLA2G7 natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Platelet-activating factor acetylhydrolase, also known as 1-alkyl-2-acetylglycerophosphocholine esterase, 2-acetyl-1-alkylglycero-phosphocholine esterase, Group-VIIA phospholipase A2, LDL-associated phospholipase A2, PAF 2-acylhydrolase, PLA2G7 and PAFAH, is secreted protein which belongs to the AB hydrolase superfamily and Lipase family. PLA2G7 / PAFAH modulates the action of platelet-activating factor (PAF) by hydrolyzing the sn-2 ester bond to yield the biologically inactive lyso-PAF. It has a specificity for substrates with a short residue at the sn-2 position. It is inactive against long-chain phospholipids. PLA2G7 / PAFAH is a potent pro- and anti-inflammatory molecule that has been implicated in multiple inflammatory disease processes, including cardiovascular disease. PLA2G7 also represents an important, potentially functional candidate in the pathophysiology of coronary artery disease (CAD). Defects in PLA2G7 are the cause of platelet-activating factor acetylhydrolase deficiency (PLA2G7 deficiency). It is a trait which is present in 27% of Japanese. It could have a significant physiologic effect in the presence of inflammatory bodily responses.

References
  • Stafforini D.M., et al., 1996, J. Clin. Invest. 97:2784-2791.
  • Yoshida H., et al., 1998, Thromb. Haemost. 80:372-375.
  • Yamada Y., et al., 1998, Metabolism 47:177-181.
  • Kruse S., et al., 2000, Am. J. Hum. Genet. 66:1522-1530. 
  • Size / Price
    Catalog: HG10848-NH
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"