Quick Order

Ferret PRMT6 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Ferret PRMT6 cDNA Clone Product Information
NCBI RefSeq:XM_004777503.1
RefSeq ORF Size:1128bp
cDNA Description:Full length Clone DNA of Mustela putorius furo (sub-species: furo) protein arginine methyltransferase 6 with C terminal HA tag.
Gene Synonym:PRMT6
Species:Ferret
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Protein arginine N-methyltransferase 6, also known as Histone-arginine N-methyltransferase PRMT6, PRMT6, and HRMT1L6, is a member of the protein arginine N-methyltransferase family and PRMT6 subfamily. PRMT6 is highly expressed in kidney and testes. PRMT6 is known to catalyze the generation of asymmetric dimethylarginine in polypeptides. It has been implicated in human immunodeficiency virus pathogenesis, DNA repair, and transcriptional regulation. PRMT6 is known to methylate histone H3 Arg-2 (H3R2), and this negatively regulates the lysine methylation of H3K4 resulting in gene repression. PRMT6 plays a key role in coupling process by functioning as a transcriptional coactivator that can regulate alternative splicing. PRMT6 coactivates the progesterone, glucocorticoid and oestrogen receptors in luciferase reporter assays in a hormone-dependent manner. Small interfering RNA (siRNA) oligonucleotide duplex knockdown of PRMT6 disrupts oestrogen-stimulated transcription of endogenous GREB1 and progesterone receptor in MCF-7 breast cancer cells. Neutralizing the activity of PRMT6 could inhibit tumor progression and may be of cancer therapeutic significance.

References
  • Hyllus D, et al., 2007, Genes Dev. 21(24): 3369-80.
  • Lakowski, TM. et al., 2008, J Biol Chem. 283 (15): 10015-25. 
  • Michaud-Levesque, J. et al., 2009, J Biol Chem. 284 (32): 21338-46.
  • Harrison, MJ. et al., 2010, Nucleic acids Res. Jan 4.
  • Size / Price
    Catalog: FG60131-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"