Quick Order

Text Size:AAA

Human YWHAH ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human YWHAH cDNA Clone Product Information
Gene_bank_ref_id:NM_003405.3
RefSeq ORF Size:741bp
cDNA Description:Full length Clone DNA of Homo sapiens tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide with N terminal His tag.
Gene Synonym:YWHA1
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Wakui H, et al. (1997) Interaction of the ligand-activated glucocorticoid receptor with the 14-3-3 eta protein. J Biol Chem. 272(13): 8153-6.
  • Toyooka K, et al. (2002) Isolation and structure of the mouse 14-3-3 eta chain gene and the distribution of 14-3-3 eta mRNA in the mouse brain. Brain Res Mol Brain Res. 100(1-2): 13-20.
  • Kim YS, et al. (2005) Role of 14-3-3 eta as a positive regulator of the glucocorticoid receptor transcriptional activation. Endocrinology. 146(7): 3133-40.
  • Grover D, et al. (2009) Family-based association of YWHAH in psychotic bipolar disorder. Am J Med Genet B Neuropsychiatr Genet. 150B(7): 977-83.
  • Size / Price
    Catalog: HG10847-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"