After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human KLK6 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KLK6 cDNA Clone Product Information
Gene_bank_ref_id:BC015525
RefSeq ORF Size:735bp
cDNA Description:Full length Clone DNA of Homo sapiens kallikrein-related peptidase 6 with C terminal His tag.
Gene Synonym:hK6, Bssp, Klk7, SP59, PRSS9, PRSS18, MGC9355, KLK6
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

KLK6 (kallikrein-related peptidase 6), also known as Klk7, belongs to the peptidase S1 family, Kallikrein subfamily. Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. KLK6 is a serine protease which exhibits a preference for Arg over Lys in the substrate P1 position and for Ser or Pro in the P2 position. Klk7 shows activity against amyloid precursor protein, myelin basic protein, gelatin, casein and extracellular matrix proteins such as fibronectin, laminin, vitronectin and collagen. KLK6 degrades alpha-synuclein and prevents its polymerization, indicating that KLK6 may be involved in the pathogenesis of Parkinson disease and other synucleinopathies. Klk7 may be involved in regulation of axon outgrowth following spinal cord injury. Tumor cells treated with a neutralizing KLK6 antibody migrate less than control cells, suggesting a role in invasion and metastasis.

References
  • Krenzer S, et al. (2011) Expression and function of the kallikrein-related peptidase 6 in the human melanoma microenvironment. J Invest Dermatol. 131(11):2281-8.
  • Nathalie HV, et al. (2009) High kallikrein-related peptidase 6 in non-small cell lung cancer cells: an indicator of tumour proliferation and poor prognosis. J Cell Mol Med. 13(9B):4014-22.
  • Kim JT, et al. (2011) Up-regulation and clinical significance of serine protease kallikrein 6 in colon cancer. Cancer. 117(12):2608-19.
  • Scarisbrick IA, et al. (2011) Functional role of kallikrein 6 in regulating immune cell survival. PLoS One. 6(3):e18376.
  • Size / Price
    Catalog: HG12142-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"