Quick Order

Text Size:AAA

Human LMAN2L ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LMAN2L cDNA Clone Product Information
Gene_bank_ref_id:BC067265
RefSeq ORF Size:1047bp
cDNA Description:Full length Clone DNA of Homo sapiens lectin, mannose-binding 2-like with N terminal Myc tag.
Gene Synonym:PSEC0028, DKFZp564L2423, MGC11139, VIPL, LMAN2L
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

LMAN2L contains 1 L-type lectin-like domain and is expressed in numerous tissues. It is highly expressed in skeletal muscle and kidney, and its intermediate expression levels in heart, liver and placenta, low levels in brain, thymus, spleen, small intestine and lung. LMAN2L may be involved in the regulation of export from the endoplasmic reticulum of a subset of glycoproteins. It also may function as a regulator of ERGIC-53. LMAN2L gene may be modulated by acetylation; phosphorylation, as detailed at PhosphoSite. Alternative splicing produces 2 isoforms of the human protein. LMAN2L localize in various compartments.

References
  • Hartley JL, et al. (2001) DNA cloning using in vitro site-specific recombination. Genome Res. 10 (11):1788-95.
  • Suzuki Y, et al. (1997) Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library. Gene. 200(1-2):149-56.
  • Maruyama K, et al. (1994) Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene. 138(1-2):171-4.
  • Size / Price
    Catalog: HG13822-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"