Quick Order

Human HRG / HPRG Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HRGcDNA Clone Product Information
cDNA Size:1578
cDNA Description:ORF Clone of Homo sapiens histidine-rich glycoprotein DNA.
Gene Synonym:HPRG, HRGP, DKFZp779H1622, HRG
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Histidine-rich glycoprotein, also known as HRG and HPRG, is a glycoprotein located in plasma and platelets, and contains an unusually large amount of histidine and proline. In human, five distinct domains are recognized in the mature HPRG molecule. There are two N-terminal cystatin-like modules (aa 19 - 254) and one His-Pro-rich region (aa 350 - 497) that is flanked by two Pro-rich segments (aa 276 - 321 and 498 - 525). The His-Pro-rich region contains 10 tandem repeats with an HHPHG motif, and the N- and C-termini are linked by a disulfide bond. The specific functions of HRG remain unclear, but it is known that the protein binds heme, dyes and divalent metal ions. It inhibits rosette formation and interacts with heparin, thrombospondin and plasminogen. Two of the protein's effects, the inhibition of fibrinolysis and the reduction of inhibition of coagulation, indicate a potential prothrombotic effect. HPRG is evolutionarily, functionally and structurally related to cleaved high molecular weight kininogen (HKa), an anti-angiogenic polypeptide that stimulates apoptosis of proliferating endothelial cells through binding to cell-surface tropomyosin. The antiangiogenic activity of the multidomain plasma protein HPRG is localized to its histidine-proline-rich (H/P) domain and has recently been shown to be mediated, at least partially, through binding to cell-surface tropomyosin in fibroblast growth factor-2-activated endothelial cells.

  • Guan X, et al. (2004) Histidine-proline rich glycoprotein (HPRG) binds and transduces anti-angiogenic signals through cell surface tropomyosin on endothelial cells. Thromb Haemost. 92(2): 403-12.
  • Doate F, et al. (2004) Peptides derived from the histidine-proline domain of the histidine-proline-rich glycoprotein bind to tropomyosin and have antiangiogenic and antitumor activities. Cancer Res. 64(16): 5812-7.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items