Quick Order

Human CLEC10A transcript variant 2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CLEC10A cDNA Clone Product Information
Gene_bank_ref_id:NM_006344.2
RefSeq ORF Size:879bp
cDNA Description:Full length Clone DNA of Homo sapiens C-type lectin domain family 10, member A , transcript variant 2 with N terminal His tag.
Gene Synonym:HML, HML2, CD301, CLECSF13, CLECSF14, CLEC10A
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

CLEC10A, also known as the macrophage galactose-type calcium-type lectins (MGLs; CD301) constitute a unique class of C-type lectins because of their specificity for galactose and its structural homologues. MGLs/CD301 is a type II transmembrane glycoproteins and is expressed on macrophages and related cells of myeloid origins, particularly immature dendritic cells (DCs). There are 2 homologues: MGL1 and MGL2 (CD301a and CD301b) in mice. MGL1/CD301a induces both the production and secretion of interleukin (IL)-10. MGL1/CD301a plays a protective role against colitis by effectively inducing IL-10 production by colonic lamina propria macrophages in response to invading commensal bacteria.

References
  • Saba K, et al. (2009) A C-type lectin MGL1/CD301a plays an anti-inflammatory role in murine experimental colitis. Am J Pathol. 174(1): 144-52.
  • Suzuki N, et al. (2002) Molecular cloning and expression of cDNA encoding human macrophage C-type lectin: its unique carbohydrate binding specificity for Tn antigen. J Immunol. 1996 ;156: 128-135.
  • Tsuiji M, et al. (2002) Molecular cloning and characterization of a novel mouse macrophage C-type lectin, mMGL2, which has a distinct carbohydrate specificity from mMGL1. J Biol Chem. 277: 28892-28901.
  • Denda-Nagai K, et al. (2002) Macrophage C-type lectin on bone marrow-derived immature dendritic cells is involved in the internalization of glycosylated antigens. Glycobiology. 12: 443-450.
  • Size / Price
    Catalog: HG10821-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"