Quick Order

Human PRSS27 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PRSS27 cDNA Clone Product Information
Gene_bank_ref_id:NM_031948.3
RefSeq ORF Size:873bp
cDNA Description:Full length Clone DNA of Homo sapiens protease, serine 27 with C terminal His tag.
Gene Synonym:MPN, CAPH2, PRSS27
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

The name "Pancreasin" because it is transcribed strongly in the pancreas. This secreted, tryptic serine protease, also known as Marapsin or PRSS27 (Protease, serine, 27), which is a member of the peptidase S1 family. Pancreasin is inhibited by benzamidine and leupeptin but resists several classic inhibitors of trypsin. Marapsin was constitutively expressed in nonkeratinizing stratified squamous epithelia of human esophagus, tonsil, cervix, larynx, and cornea. In fact, marapsin was the second most strongly up-regulated protease in psoriatic lesions, where expression was localized to the upper region of the hyperplastic epidermis. Similarly, in the hyperproliferative epithelium of regenerating murine skin wounds, marapsin localized to the suprabasal layers, where keratinocytes undergo squamous differentiation. Marapsin's restricted expression, localization, and cytokine-inducible expression suggest a role in the terminal differentiation of keratinocytes in hyperproliferating squamous epithelia.

References
  • Bhagwandin VJ, et al. (2003) Structure and activity of human pancreasin, a novel tryptic serine peptidase expressed primarily by the pancreas. J Biol Chem. 278(5): 3363-71.
  • Li W, et al. (2009) The serine protease marapsin is expressed in stratified squamous epithelia and is up-regulated in the hyperproliferative epidermis of psoriasis and regenerating wounds. J Biol Chem. 284(1): 218-28.
  • Size / Price
    Catalog: HG12116-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"