After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human DNASE1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DNASE1 cDNA Clone Product Information
Gene_bank_ref_id:BC029437
RefSeq ORF Size:849bp
cDNA Description:Full length Clone DNA of Homo sapiens deoxyribonuclease I with N terminal Myc tag.
Gene Synonym:DKFZp686H0155, DNL1, DRNI, FLJ38093, FLJ44902, DNASE1
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

DNase1, also known as deoxyribonuclease I and DNL1, is a member of the DNase family. DNaseI is a nuclease that cleaves DNA preferentially at phosphodiester linkages adjacent to a pyrimidine nucleotide, yielding 5'-phosphate-terminated polynucleotides with a free hydroxyl group on position 3', on average producing tetranucleotides. DNaseI binds to the cytoskeletal protein actin. It binds actin monomers with very high (sub-nanomolar) affinity and actin polymers with lower affinity. Mutations in DNase1 gene have been associated with systemic lupus erythematosus (SLE), an autoimmune disease. DNase1 is used to treat the one of the symptoms of cystic fibrosis by hydrolyzing the extracellular DNA in sputum and reducing its viscosity.

References
  • Shak S. et al., 1991, Proc Natl Acad Sci. 87 (23): 9188-92.
  • Yasutomo K. et al., 2001, Nat Genet. 28 (4): 313-4.
  • Hakkim A. et al., 2010, Proc Natl Acad Sci. 107 (21): 9813-8.
  • Size / Price
    Catalog: HG13801-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"