After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human FABP4 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FABP4 cDNA Clone Product Information
Gene_bank_ref_id:NM_001442.2
RefSeq ORF Size:399bp
cDNA Description:Full length Clone DNA of Homo sapiens fatty acid binding protein 4, adipocyte with C terminal His tag.
Gene Synonym:aP2, A-FABP, FABP4
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Mouse fatty acid-binding protein, adipocyte, also known as Adipocyte-type fatty acid-binding protein, Fatty acid-binding protein 4, Adipocyte lipid-binding protein, and FABP4, is a cytoplasm protein which belongs to the calycin superfamily and Fatty-acid binding protein (FABP) family. In familial combined hyperlipidemia (FCHL), FABP4 correlated to body mass index (BMI), waist circumference and homeostasis model assessment (HOMA) index.FABP4 levels were associated with triglyceride-rich lipoproteins. In humans serum FABP4 levels correlate significantly with features of PCOS. It appears to be a determinant of atherogenic dyslipidemia. FABP4 pathway mediates the sebaceous gland hyperplasia in keratinocyte-specific Pten-null mice. FABP4 concentration significantly increased with an increasing of MS features and was strongly correlated with body-mass index, triglycerides, HDL-cholesterol concentrations and blood pressure. Patients in the highest quartile of FABP4 presented a six-fold increased odds ratio for MS and a three-fold increased odds for LD, adjusted by age, sex, body-mass index and the antiretroviral therapy. FABP4 is a strong plasma marker of metabolic disturbances in HIV-infected patients, and therefore, could serve to guide therapeutic intervention in this group of patients.

References
  • van Dongen,M.J. et al., 2002, J Am Chem Soc. 124 (40): 11874-80.
  • Coll, B. et al., 2008, Atherosclerosis  199 (1):147-53.
  • Hoashi,S. et al., 2008, BMC Genet. 9 :84.
  • Cai,H. et al., 2010, Bioorg Med Chem Lett  20 (12):3675-9.
  • Size / Price
    Catalog: HG12109-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"