Quick Order

Human HNF4A transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HNF4AcDNA Clone Product Information
Gene_bank_ref_id:NM_178850
cDNA Size:1254
cDNA Description:ORF Clone of Homo sapiens hepatocyte nuclear factor 4, alpha, transcript variant 3 DNA.
Gene Synonym:TCF, HNF4, MODY, MODY1, NR2A1, TCF14, HNF4a7, HNF4a8, HNF4a9, NR2A21, FLJ39654, HNF4alpha, HNF4A
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human HNF4A transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human HNF4A transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG12105-ACG$325
Human HNF4A transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG12105-ACR$325
Human HNF4A transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG12105-ANG$325
Human HNF4A transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG12105-ANR$325
Human HNF4A transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG12105-CF$295
Human HNF4A transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG12105-CH$295
Human HNF4A transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG12105-CM$295
Human HNF4A transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG12105-CY$295
Human HNF4A transcript variant 3 Gene cDNA Clone (full-length ORF Clone)HG12105-G$125
Human HNF4A transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG12105-G-F$325
Human HNF4A transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG12105-NF$295
Human HNF4A transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG12105-NH$295
Human HNF4A transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG12105-NM$295
Human HNF4A transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG12105-NY$295
Human HNF4A transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG12105-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"