Quick Order

Text Size:AAA

Human KCT2 / C5orf15 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KCT2 cDNA Clone Product Information
Gene_bank_ref_id:BC020875
RefSeq ORF Size:798bp
cDNA Description:Full length Clone DNA of Homo sapiens chromosome 5 open reading frame 15 with N terminal Myc tag.
Gene Synonym:HTGN29, KCT2, C5orf15
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

KCT2, also known as C5orf15, KCT2 gene maps to human chromosome 5q31.1 and is conserved in human, chimpanzee, cow, rat, and chicken. KCT2 is a 265 amino acid single-pass type I membrane protein that is widely expressed. Chromosome 5 is associated with Cockayne syndrome through the ERCC8 gene and familial adenomatous polyposis through the adenomatous polyposis coli (APC) tumor suppressor gene. Chromosome 5 contains 181 million base pairs and comprises nearly 6% of the human genome.

Size / Price
Catalog: HG13794-NM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"