Quick Order

Text Size:AAA

Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MAPK8cDNA Clone Product Information
Gene_bank_ref_id:NM_001278547.1
cDNA Size:1284
cDNA Description:ORF Clone of Homo sapiens mitogen-activated protein kinase 8, transcript variant JNK1-b2 DNA.
Gene Synonym:JNK, JNK1, PRKM8, SAPK1, JNK1A2, JNK21B1/2
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10795-ACG$325
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10795-ACR$325
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10795-ANG$325
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10795-ANR$325
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10795-CF$295
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10795-CH$295
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10795-CM$295
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10795-CY$295
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone)HG10795-M$95
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10795-M-F$295
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10795-M-N$295
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10795-NF$295
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10795-NH$295
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10795-NM$295
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10795-NY$295
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10795-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Mitogen-activated protein kinase 8 (MAPK8), also known as JNK1, is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The protein kinases JNK1 has been found to serve as critical molecular links between obesity, metabolic inflammation, and disorders of glucose homeostasis. It is critically involved in the promotion of diet-induced obesity, metabolic inflammation and beta-cell dysfunction. The selective deficiency of JNK1 in the murine nervous system is sufficient to suppress diet-induced obesity. Genetic analysis indicates that the effects of JNK1 can be separated from effects of JNK1 on obesity. JNK1 is a potential pharmacological target for the development of drugs that might be useful for the treatment of metabolic syndrome, and type 2 diabetes. Furthermore, JNK1 plays a major role in the hypoxic cellular damage. JNK1 protein might be an attractive target for antihypoxic therapy in increasing resistance to many pathological conditions and diseases, leading to the oxygen deficit.

References
  • Betigeri S, et al. (2006) JNK1 as a molecular target to limit cellular mortality under hypoxia. Mol Pharm. 3(4): 424-30.
  • Solinas G, et al. (2010) JNK1 and IKKbeta: molecular links between obesity and metabolic dysfunction. FASEB J. 24(8): 2596-611.
  • Sabio G, et al. (2010) Role of the hypothalamic-pituitary-thyroid axis in metabolic regulation by JNK1. Genes Dev. 24(3): 256-64.
  • Size / Price
    Catalog:HG10795-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"