After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human RGMA Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RGMAcDNA Clone Product Information
Gene_bank_ref_id:NM_020211
cDNA Size:1353
cDNA Description:ORF Clone of Homo sapiens RGM domain family, member A DNA.
Gene Synonym:RGM
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

RGMa, also known as RGM domain family, member A, belongs to the RGM (repulsive guidance molecule) family whose members are membrane-associated glycoprotein. RGMa is a glycosylphosphatidylinositol-anchored glycoprotein that functions as an axon guidance protein in the developing and adult central nervous system. It helps guide Retinal Ganglion Cell (RGC) axons to the tectum in the midbrain. RGMa has been implicated to play an important role in the developing brain and in the scar tissue that forms after a brain injury. This protein may also function as a tumor suppressor in some cancers.

References
  • Severyn CJ, et al. (2009). Molecular biology, genetics and biochemistry of the repulsive guidance molecule family. Biochem J. 422 (3): 393-403.
  • Monnier PP, et al. (2002) RGM is a repulsive guidance molecule for retinal axons. Nature. 419: 392-5.
  • Matsunaga E, et al. (2004) RGM and its receptor neogenin regulate neuronal survival. Nature Cell Biology. 6: 749-55.
  • Size / Price
    Catalog:HG12086-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"