After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CNPY2 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CNPY2 cDNA Clone Product Information
Gene_bank_ref_id:BC065015
RefSeq ORF Size:549bp
cDNA Description:Full length Clone DNA of Homo sapiens canopy 2 homolog (zebrafish) with N terminal Myc tag.
Gene Synonym:UNQ1943/PRO4426, HP10390, MSAP, TMEM4, ZSIG9, CNPY2
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

CNPY2 is a novel MIR-interacting protein that enhances neurite outgrowth and increases myosin regulatory light chain. CNPY2 enhances migration of C6 glioma cells through phosphorylation of the myosin regulatory light chain. It is expressed in different tissues, including brain. Overexpression of CNPY2 enhanced the motility of glioma cells measured in matrigel invasion chambers and using a scratch assay. Downregulation of CNPY2 by RNA interference significantly decreased glioma cell migration and phosphorylation of MRLC. Inhibition of the corresponding MRLC kinase by ML-7 did not affect migration of CNPY2-overexpressing cells.

References
  • Trynka G, et al. (2009) Coeliac disease-associated risk variants in TNFAIP3 and REL implicate altered NF-kappaB signalling. Gut. 58(8):1078-83.
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Size / Price
    Catalog: HG13771-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"