Quick Order

Human CD30 / TNFRSF8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TNFRSF8cDNA Clone Product Information
Gene_bank_ref_id:NM_001243.3
cDNA Size:1788
cDNA Description:ORF Clone of Homo sapiens tumor necrosis factor receptor superfamily, member 8 DNA.
Gene Synonym:CD30, KI-1, D1S166E
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Tumor Necrosis Factor (TNF) & Receptor Related Products
Product nameProduct name
Canine CD40 / TNFRSF5 Protein (Fc Tag)Rat BAFFR / TNFRSF13C Protein (Fc Tag)Canine CD40 / TNFRSF5 ProteinHuman Fas Ligand / FASLG / CD95L Protein (His Tag)Human 4-1BBL / CD137L Protein (Fc Tag, ECD)Canine CD40L / CD154 / TNFSF5 Protein (Fc Tag)Canine CD40L / CD154 / TNFSF5 ProteinCanine CD40 / TNFRSF5 Protein (His Tag)Human GITR / TNFRSF18 Protein (His Tag, ECD)Canine CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Cynomolgus LTB / TNFSF3 / Lymphotoxin beta Protein (His Tag)Cynomolgus TNFRSF21 / DR6 Protein (His Tag)Cynomolgus TNF-alpha / TNFA ProteinHuman XEDAR / EDA2R Protein (Fc Tag)Cynomolgus XEDAR / EDA2R Protein (ECD, His Tag)Human CD40 / TNFRSF5 Protein (ECD, Fc Tag)Cynomolgus RANKL / OPGL / TNFSF11 Protein (Fc Tag)Human CD27 / TNFRSF7 Protein (His & Fc Tag)Human CD27 / TNFRSF7 Protein (His Tag)Human CD27 / TNFRSF7 Protein (Fc Tag)Human CD153 / CD30L / TNFSF8 Protein (Fc Tag)Human CD137 / 4-1BB / TNFRSF9 Protein (His & Fc Tag)Human CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Human BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human BLyS / TNFSF13B / BAFF ProteinHuman BLyS / TNFSF13B / BAFF ProteinHuman DR6 / TNFRSF21 Protein (Fc Tag)Human DR6 / TNFRSF21 Protein (His Tag)Human DR6 / TNFRSF21 ProteinHuman FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Human FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Human DCR3 / TNFRSF6B Protein (Fc Tag)Human CD40L / CD154 / TNFSF5 Protein (Fc Tag)Human CD40L / CD154 / TNFSF5 Protein (His Tag)Human TNF-beta / TNFSF1 / Lymphotoxin alpha ProteinHuman Osteoprotegerin / TNFRSF11B Protein (His Tag)Human HVEM / TNFRSF14 Protein (His & Fc Tag)Human HVEM / TNFRSF14 Protein (His Tag)Human TNFSF14 / LIGHT / CD258 Protein (His Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (Fc Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (His & Fc Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (His Tag)Human TNFSF10 / TRAIL / APO-2L / CD253 ProteinHuman TRAIL R4 / CD264 / TNFRSF10D Protein (His & Fc Tag)Human TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His & Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Human TNFRSF12A / FN14 / TWEAKR Protein (Fc Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Human TNFRSF4 / OX40 / CD134 Protein (His & Fc Tag)Human TNFRSF4 / OX40 / CD134 Protein (His Tag)Human RELT / TNFRSF19L Protein (His & Fc Tag)Human RELT / TNFRSF19L Protein (His Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Human TNF-alpha / TNFA ProteinHuman TNFRSF17 / BCMA / CD269 Protein (His & Fc Tag)Canine BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human CD40 / TNFRSF5 Protein (His & Fc Tag)Human CD40 / TNFRSF5 Protein (His Tag)Human CD30 / TNFRSF8 Protein (His & Fc Tag)Human CD30 / TNFRSF8 Protein (His Tag)Human CD70 / CD27L / TNFSF7 Protein (Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His & Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 ProteinHuman EDAR / DL Protein (Fc Tag)Human EDAR / DL Protein (His Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 ProteinHuman XEDAR / EDA2R Protein (His Tag)Human TNFRSF13B / TACI / CD267 Protein (His Tag)Human TNFRSF25 / DR3 / TNFRSF12 Protein (Fc Tag)Human NGFR / P75 Protein (Fc Tag)Human NGFR/ P75 Protein (His Tag)Human TNFRSF19 / TROY Protein (Fc Tag)Human TNFRSF19 / TROY Protein (His Tag)Human GITR / TNFRSF18 Protein (Fc Tag)Mouse FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Mouse 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Mouse TNFRSF17 / BCMA Protein (Fc Tag)Mouse TNFRSF17 / BCMA Protein (His & Fc Tag)Mouse CD27 / TNFRSF7 Protein (His & Fc Tag)Mouse CD27 / TNFRSF7 Protein (His Tag)Mouse PGLYRP1 / PGRP-S Protein (His Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Mouse TNFRSF19 / TROY Protein (His & Fc Tag)Mouse TNFRSF19 / TROY Protein (His Tag)Mouse TNFSF10 / TRAIL / APO-2L Protein (aa 118-291, His Tag)Mouse DR6 / TNFRSF21 Protein (His Tag)Mouse CD40 / TNFRSF5 Protein (His & Fc Tag)Mouse CD40L / CD154 / TNFSF5 Protein (Fc Tag)Mouse RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Mouse TNF-alpha / TNFA ProteinMouse BAFFR / TNFRSF13C / CD268 Protein (Fc Tag)Mouse XEDAR / EDA2R Protein (Fc Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Mouse TNFRSF4 / OX40 / CD134 Protein (Fc Tag)Mouse CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Mouse TNFSF13 Protein (Fc Tag)Mouse NGFR / P75 Protein (Fc Tag)Mouse NGFR / P75 Protein (His Tag)Rat CD40L / CD154 / TNFSF5 Protein (Fc Tag)Ferret TNF-alpha / TNFA ProteinCanine TNF-alpha / TNFA / TNFSF1A ProteinCanine CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Rat TNF-alpha / TNFA ProteinRat CD153 / CD30L / TNFSF8 Protein (Fc Tag)Rat CD153 / CD30L / TNFSF8 ProteinRat TNFSF15 / TL1A Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (His Tag)Rat TNFRSF17 / BCMA Protein (Fc Tag)Rat TNFRSF11A Protein (Fc Tag)Rat TNFRSF11A Protein (His Tag)Rat CD70 / CD27L / TNFSF7 Protein (Fc Tag)Rat CD70 / CD27L / TNFSF7 Protein (His Tag)Rat 4-1BBL / CD137L / TNFSF9 Protein (Fc Tag) Rat 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Rat BAFFR / TNFRSF13C Protein (His Tag)Rat LTBR / TNFRSF3 Protein (Fc Tag)Rat LTBR / TNFRSF3 Protein (His Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Rat GITR / TNFRSF18 Protein (Fc Tag)Rat XEDAR / EDA2R Protein (Fc Tag)Rat XEDAR / EDA2R Protein (His Tag)Rat EDAR Protein (Fc Tag)Cynomolgus / Rhesus TNF-alpha / TNFA / TNFSF1A / Cachectin ProteinCynomolgus CD27 / TNFRSF7 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (His Tag)Cynomolgus CD40L / CD154 / TNFSF5 Protein (Fc Tag) Cynomolgus / Rhesus CD40 / TNFRSF5 Protein (Fc Tag)Cynomolgus / Rhesus CD40 / TNFRSF5 Protein (His Tag)Cynomolgus TNFSF10 / TRAIL / APO-2L ProteinCynomolgus TRAIL R4 / CD264 / TNFRSF10D Protein (Fc Tag)Cynomolgus TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Cynomolgus LTBR / TNFRSF3 Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Cynomolgus / Rhesus TNFRSF17 / BCMA Protein (Fc Tag)Cynomolgus HVEM / TNFRSF14 Protein (Fc Tag)Cynomolgus XEDAR / EDA2R Protein (Fc Tag)Cynomolgus EDAR Protein (Fc Tag)Cynomolgus EDAR Protein (His Tag)Cynomolgus Osteoprotegerin / TNFRSF11B Protein (Fc Tag)Cynomolgus BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human TNFRSF11A Protein (Fc Tag)Human TNF-alpha / TNFA Protein (Fc Tag)Human TNFRSF11A Protein (His Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Cynomolgus OX-40L / TNFSF4 Protein (Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (aa 1-268, 196 Met/Arg, His Tag)
Background

CD30, also known as TNFRSF8, is a cell membrane protein of the tumor necrosis factor receptor (TNFR) superfamily. CD30 protein is expressed by activated, but not resting, T and B cells. CD30 can regulate proliferation of lymphocytes and may also play an important role in human immunodeficiency virus replication. As a regulator of apoptosis, CD30 protein induces cell death or proliferation, depending on the cell type, and has been shown to limit the proliferative potential of autoreactive CD8 effector T cells and protect the body against autoimmunity. CD30 protein expression is upregulated in various hematological malignancies, including Reed-Sternberg cells in Hodgkin's disease (HD), anaplastic large cell lymphoma (ALCL) and subsets of Non-Hodgkin's lymphomas (NHLs), and CD30 is also linked to leukocytes in patients with chronic inflammatory diseases, including lupus erythematosus, asthma, rheumatoid arthritis and atopic dermatitis (AD).

References
  • Rossi FM, et al. (2001) CD30L up-regulates CD30 and IL-4 expression by T cells. FEBS Lett. 508(3): 418-22.
  • Trovato M, et al. (2001) Expression of CD30 ligand and CD30 receptor in normal thyroid and benign and malignant thyroid nodules. Thyroid. 11(7): 621-8.
  • Ekstrom ES, et al. (2001) Presence of CD30(+) and CD30L(+) cells in human placenta and soluble CD30 levels in cord blood are independent of maternal atopy. Placenta. 22(4): 372-9.
  • Tang C, et al. (2008) A novel role of CD30L/CD30 signaling by T-T cell interaction in Th1 response against mycobacterial infection. J Immunol. 181(9): 6316-27.
  • Sun X, et al. (2008) A critical role of CD30 ligand/CD30 in controlling inflammatory bowel diseases in mice. Gastroenterology. 134(2): 447-58.
  • Oflazoglu E, et al. (2009) Targeting CD30/CD30L in Oncology and Autoimmune and Inflammatory Diseases.Adv Exp Med Biol. 647: 174-85.
  • Size / Price
    Catalog:HG10777-NH
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"