Quick Order

Human KLK-3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
KLK3cDNA Clone Product Information
Gene_bank_ref_id:NM_001648.2
cDNA Size:786
cDNA Description:ORF Clone of Homo sapiens kallikrein-related peptidase 3 , transcript variant 1 DNA.
Gene Synonym:APS, PSA, hK3, KLK2A1
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human KLK-3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged on other vectors
Human KLK-3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10771-ACG$325
Human KLK-3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10771-ACR$325
Human KLK-3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10771-CF$295
Human KLK-3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10771-CH$295
Human KLK-3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10771-CM$295
Human KLK-3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10771-CY$295
Human KLK-3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10771-M$95
Human KLK-3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10771-M-F$295
Human KLK-3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10771-M-N$295
Human KLK-3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10771-NF$295
Human KLK-3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10771-NH$295
Human KLK-3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10771-NM$295
Human KLK-3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10771-NY$295
Human KLK-3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10771-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
References
  • Koistinen H, et al. (2008) Development of peptides specifically modulating the activity of KLK2 and KLK3. Biol Chem. 389(6): 633-42.
  • Yousef GM, et al. (2002) Kallikreins, steroid hormones and ovarian cancer: is there a link? Minerva Endocrinol. 27(3): 157-66.
  • Parikh H, et al. (2011) Fine mapping the KLK3 locus on chromosome 19q13.33 associated with prostate cancer susceptibility and PSA levels. Hum Genet. 129(6): 675-85.
  • Size / Price
    Catalog:HG10771-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"