After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human GREM1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GREM1 cDNA Clone Product Information
NCBI RefSeq:NM_013372.5
RefSeq ORF Size:555bp
cDNA Description:Full length Clone DNA of Homo sapiens gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis) with N terminal His tag.
Gene Synonym:DRM, PIG2, DAND2, IHG-2, GREMLIN, CKTSF1B1, MGC126660
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

GREM1 belongs to the DAN family. It contains 1 CTCK (C-terminal cystine knot-like) domain. GREM1 is a cysteine knot-secreted protein and acts as an inhibitor in the TGF beta signaling pathway. It inhibits BMP-2, -4, and -7. Inhibition by grem 1 of BMPs in mice allow the expression of fibroblast growth factors (FGFs) 4 and 8 and Sonic hedgehog (SHH) which are necessary for proper limb development. It interacts with SLIT1 and SLIT2 in a glycosylation-dependent manner. As a cytokine, GREM1 may play an important role during carcinogenesis and metanephric kidney organogenesis, as a BMP antagonist required for early limb outgrowth and patterning in maintaining the FGF4-SHH feedback loop. It down-regulates the BMP4 signaling in a dose-dependent manner. It also acts as inhibitor of monocyte chemotaxis. GREM1 is highly expressed in small intestine, fetal brain and colon.

References
  • Dimitrov BI, et al. (2010) Genomic rearrangements of the GREM1-FMN1 locus cause oligosyndactyly, radio-ulnar synostosis, hearing loss, renal defects syndrome and Cenani--Lenz-like non-syndromic oligosyndactyly. J Med Genet. 47(8):569-74.
  • Heron M, et al. (2011) Genetic variation in GREM1 is a risk factor for fibrosis in pulmonary sarcoidosis. Tissue Antigens. 77(2):112-7.
  • van Vlodrop IJ, et al. (2010) Prognostic significance of Gremlin1 (GREM1) promoter CpG island hypermethylation in clear cell renal cell carcinoma. Am J Pathol. 176(2):575-84.
  • Size / Price
    Catalog: HG10632-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"