Quick Order

Human MAPK10 transcript variant 1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MAPK10 cDNA Clone Product Information
Gene_bank_ref_id:NM_002753.2
RefSeq ORF Size:1269bp
cDNA Description:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 10, transcript variant 1 with N terminal His tag.
Gene Synonym:JNK3, JNK3A, PRKM10, p493F12, FLJ12099, FLJ33785, MGC50974, p54bSAPK
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human MAPK10 transcript variant 1 ORF mammalian expression plasmid, N-His tag on other vectors
Product nameProduct name
Size / Price
Catalog: HG10626-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"