Quick Order

Human STX3 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human STX3 cDNA Clone Product Information
NCBI RefSeq:BC007405
RefSeq ORF Size:870bp
cDNA Description:Full length Clone DNA of Homo sapiens syntaxin 3 with C terminal Myc tag.
Gene Synonym:STX3A
Species:Human
Vector:pCMV3-C-Myc
Plasmid:pCMV3-STX3-Myc
Restriction Site:KpnI + XbaI (6kb + 0.92kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human STX3 Gene Plasmid Map
Human STX3 natural ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

STX3, also known as syntaxin 3, belongs to the syntaxin family. STX3 is a target membrane protein (t-SNARE) which is needed for membrane fusion. Membrane fusion requires the formation of a complex between a vesicle protein (v-SNARE) and t-SNAREs. STX3, together with syntaxin 2, are predominantly localized at the plasma membrane. Syntaxin 2 cycles between the plasma membrane and the perinuclear compartment whereas syntaxin 3 cycles between the plasma membrane and the trans-Golgi network. It is possible that this cycling has an important role in the regulation of t-SNARE function.

References
  • Ibaraki K. et al., 1995, Biochem Biophys Res Commun. 211 (3): 997-1005
  • Martín-Martín B. et al., 1999, J Leukoc Biol. 65 (3): 397-406.
  • Darios F. et al., 2006, Nature. 440 (7085): 813-7.
  • Size / Price
    Catalog: HG14625-CM
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"