Quick Order

Text Size:AAA

Human DCBLD2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DCBLD2cDNA Clone Product Information
Gene_bank_ref_id:BC029658
cDNA Size:2232
cDNA Description:ORF Clone of Homo sapiens discoidin, CUB and LCCL domain containing 2 DNA.
Gene Synonym:ESDN, CLCP1, DCBLD2
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

DCBLD2, also known as ESDN and CLCP1, localizes in various compartments. DCBLD2 is up-regulated in lung cancers and is regulated by transcription factor AP-2 alpha (TFAP2A), a component of activator protein-2 (AP-2) that is known to regulate IL-8 production in human lung fibroblasts and epithelial cells. DCBLD2 could be related to FEV(1)-related phenotypes in asthmatics. DCBLD2 gene is expressed at very high level. DCBLD2 is proposed to participate in processes such as intracellular receptor mediated signaling pathway, negative regulation of cell growth and so on.

References
  • Kobuke K. et al., 2001, J Biol Chem. 276 (36): 34105-14.
  • Adeghi MM. et al., 2007, Am J Transplant. 7 (9): 2098-105.
  • Chen Y. et al., 2007, Proteomics. 7 (14): 2384-97.
  • Park TJ. et al., 2012, J Korean Med Sci. 27 (4): 343-9.
  • Size / Price
    Catalog:HG13615-NM
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"