After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human LTC4S Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LTC4ScDNA Clone Product Information
cDNA Size:453
cDNA Description:ORF Clone of Homo sapiens leukotriene C4 synthase DNA.
Gene Synonym:MGC33147, LTC4S
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human LTC4S Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Related Products
Product nameProduct name

Leukotriene C4 synthase, also known as LTC4 synthase, Leukotriene-C(4) synthase, and LTC4S, is a multi-pass membrane protein which belongs to the MAPEG family. LTC4S is detected in lung, platelets and the myelogenous leukemia cell line KG-1 (at protein level). LTC4S activity is present in eosinophils, basophils, mast cells, certain phagocytic mononuclear cells, endothelial cells, vascular smooth muscle cells and platelets. LTC4S is essential for the production of cysteinyl leukotrienes (Cys-LT), critical mediators in asthma. Mutagenic analysis of the conjugation function of human LTC4S has identified R51 and Y93 as critical for acid and base catalysis of LTA4 and reduced glutathione, respectively. A comparison across species for proteins that possess LTC4S activity reveals conservation of both of these residues, whereas R51 is absent in the FLAP molecules. Thus, within the glutathione S-transferase superfamily of genes, alignment of specific residues allows the separation of LTC4S family members from their most structurally similar counterparts, the FLAP molecules. Defects in LTC4S are the cause of leukotriene C4 synthase deficiency (LTC4 synthase deficiency). LTC4 synthase deficiency is a fatal neurometabolic developmental disorder. It is associated with muscular hypotonia, psychomotor retardation, failure to thrive, and microcephaly.

  • Gupta, N. et al., 1999, FEBS Lett. 449 (1): 66-70.
  • Penrose, JF. et al., 1999, Allergy Asthma Proc. 20 (6): 353-60.
  • Sayers, I. et al., 2003, Thorax. 58 (5): 417-24.
  • Schröder, O. et al., 2005, Cell Mol Life Sci. 62 (1): 87-94.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items