Quick Order

Text Size:AAA

Human CD200R1L / CD200RLa ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD200R1L cDNA Clone Product Information
Gene_bank_ref_id:NM_001008784.2
RefSeq ORF Size:816bp
cDNA Description:Full length Clone DNA of Homo sapiens CD200 receptor 1-like with C terminal His tag.
Gene Synonym:CD200R2, CD200RLa, CD200R1L
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Cell surface glycoprotein CD200 receptor 2, also known as Cell surface glycoprotein CD200 receptor 1-like, Cell surface glycoprotein OX2 receptor 2, CD200 receptor-like 2, CD200Rla, CD200R1L and CD200R2, is a single-pass type I  membrane protein which belongs to the CD200R family. CD200R1L / CD200R2. It contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. CD200 is a transmembrane protein delivering immunoregulatory signals after engagement of CD200R. A family of CD200Rs exist ( CD200R1, CD200R2, CD200R3, CD200R4 ) with different tissue expression and functional activity. In the presence of anti-CD200R2 / CD200R3 monoclonal antibodies (mAbs), bone-marrow cells cultured in the presence of (interleukin [IL]-4+granulocyte-macrophage colony-stimulating factor) differentiate into dendritic cells (DCs), which induce CD4+CD25+ Treg. Interaction between the relatively ubiquitously expressed molecule CD200 and one of its receptors, CD200R1, resulted in direct suppression of alloreactivity, engagement of alternate receptors led instead to altered differentiation of dendritic cells (DCs) from marrow precursors, which could in turn foster development of Foxp3(+) regulatory T cells. Unlike anti-CD200R1, anti-CD200R2 both promotes development of DCs with capacity to induce Treg and directly augments thymocyte production of Treg.

Size / Price
Catalog: HG11620-CH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"